Parental Strain
The strain used to generate the Nebraska Transposon Mutant Library was derived from S. aureus USA300 LAC, a highly characterized community-associated methicillin-resistant S. aureus (MRSA) strain isolated from the Los Angeles County jail (Kennedy et al., 2008). This strain contains two plasmids, one encoding macrolide resistance and another that is cryptic (Kennedy et al., 2010). For ease of genetic manipulation, and to avoid interference with subsequent transposition events involving bursa aurealis, both plasmids were cured, yielding strain USA300 JE2 that was used for all subsequent transposon mutagenesis experiments.
Kennedy AD, Otto M, Braughton KR, Whitney AR, Chen L, et al. 2008. Epidemic community-associated methicillin-resistant Staphylococcus aureus: recent clonal expansion and diversification. Proc Natl Acad Sci USA 105: 1327-1332.
Kennedy AD, Porcella SF, Martens C, Whitney AR, Braughton KR, Chen L, Craig CT, Tenover FC, Kreiswirth BN, Musser JM, DeLeo FR. 2010. Complete nucleotide sequence analysis of plasmids in strains of Staphylococcus aureus clone USA300 reveals a high level of identity among isolates with closely related core genome sequences. J Clin Microbiol. 48:4504-11.
Library Construction
The Nebraska Tn Mutant Library was made using bursa aurealis, a mariner-based transposon, in a USA300 isolate JE2, following the procedures essentially as described by Bae et al. (2008). Please also see the publication by Fey et al. (2013). Prospective mutants were arrayed and grown in a 96-well format, and then genomic DNA was isolated from each strain using Wizard Genomic DNA purification kits from Promega, Inc. Subsequent manipulations of the DNA samples, including digestion with AciI, intramolecular ligation, polymerase chain reaction (PCR) amplification, and nucleotide sequencing reactions were performed using an Eppendorf epMotion robotics platform. By determining the nucleotide sequences of the junction fragments containing the end of the Tn and the flanking DNA, the Tn insertion sites were identified for each mutant in the collection. Using sequence data generated from greater than 20,000 individual mutants screened, the precise locations of each of the transposon insertions were determined by comparison to the USA300_FPR3757 genome sequence (NCBI reference sequence NC_007793). The mutants selected for inclusion in the Nebraska Tn Mutant Library were based on the criterion that the Tn had inserted close to the 5’ end of each gene. Finally, the selected mutants were robotically re-arrayed into a 96-well format and then re-sequenced to verify the identity of each mutant. This approach resulted in the generation of 1,952 mutants that are highly likely to contain Tn insertion mutations that disrupt the functions of nearly all of the non-essential genes in the S. aureus genome.
Bae T, Glass EM, Schneewind O, and Missiakas D. 2008. Generating a collection of insertion mutations in the Staphylococcus aureus genome using bursa aurealis. Methods Mol. Biol. 416:103-116.
Fey PD, Endres JL, Yajjala VK, Widhelm TJ, Boissy RJ, Bose JL, and Bayles KW. 2013. A genetic resource for rapid and comprehensive phenotype screening of nonessential Staphylococcus aureus genes. MBio 4:e00537-12.
Confirmation of Mutations
To allow users to verify the location of the transposon insertions, we have designed primers that anneal to the bursa aurealis transposon and can be used in conjunction with a primer within the gene of interest to generate a PCR product. The primers selected for PCR reactions are dependent on the Tn orientation within the gene. For example, if the Tn is in the “plus” orientation, one would use the “Upstream” primer (see table below for sequence) in combination with the gene-specific primer. If the Tn is in the “minus” orientation, one would use the “Buster” primer in combination with the gene-specific primer. To calculate the expected product size, the user must account for the distance from the annealing site of the gene-specific primer to the “whole genome insertion site”, and then add the number of nucleotides to the Tn-specific primer used, which is 464 bp for the Upstream primer and 133 bp for the Buster primer.
| Primer Name | Primer sequence (5'-3') | Tn orientation | Distance (bp) to Tn end |
|---|---|---|---|
| Upstream | CTCGATTCTATTAACAAGGG | Plus | 464 |
| Buster | GCTTTTTCTAAATGTTTTTTAAGTAAATCAAGTAC | Minus | 133 |